Perl: caso de vida ou morte

Boas pessoal,
Estou com um grande problema num “projecto” da faculdade na cadeira de Introdução à Bioinformática. Démos umas míseras 5/6 aulas teóricas de Perl, fizémos uns quantos exercícios básicos (para principiantes mesmo) e depois o prof pede para fazermos um programa cujo enunciado éo seguinte:

Input (STDIN) Recebo uma expressão regular (ex: 112) e um ficheiro em formato FASTA (com titulo e seguido de sequência).

Para cada sequência do ficheiro tenho que imprimir o título da sequência e para cada sequência desse título imprimir a expressão regular encontrada, por ordem alfabética (não sobreposto), e localizar na sequência onde está essa expressão (ex. 000<112>334).

Finalmente, fazer estatísticas do total de ocorrências do motivo e o numero total de sequências onde o motivo foi encontrado.

O que eu precisava era mesmo de uma ajudinha :angel: e escrever assim com umas strings com operadores de gente burra (muitas loops e etc. para fazer uma coisa que se faz com um operador especial qualquer).

Também já fiz um curso intensivo de Perl mas não adquiri conhecimentos que me permitam ajudar-te nesse problema. Foram 3 dias das 9 às 17 em frente ao PC a levar a banhada teórica e a fazer exercícios básicos, portanto só deu para ficar com umas luzes.

Já agora, que manual/livro usas?

Também aprendes a programar em R no teu curso?

Boa sorte.

O “Beginning Perl for Bioinformatics, James Tisdall, O’Reilly, 2001”.

O que é programar em R? Eu nem programar em Perl sei… :-[ Dão-nos uns lamirés de Perl e depois jogam-nos às feras à espera que façamos alguma coisa :naughty:

:lol:

Não sei que curso estás a tirar mas de qualquer das formas deve ser melhor do que aquele que tirei em Coimbra, onde nem aprendi a USAR scripts, nem sequer tive uma Introdução à Bioinformática, quanto mais aprender a escrever ou programar, não obstante a importância que a informática tem para as Ciências Biológicas hoje em dia…entretanto soube há dias através de um colega meu Chinês aqui em Chicago, que na China aprende-se a programar…na Escola Primária! :slight_smile:

Help :-[
Lá venho tirar este tópico das catacumbas porque estou a fazer melhoria da cadeira e o enunciado este ano ainda é pior.

Imaginem que tenho a seguinte sequência onde encontrei o motivo “agc” e assinalei-os entre <>:

ccagtcctgtctaaggagtttggttcacgcgttaatttcggtt<agc>cagtggcgcccacgtaacaaagtgcgaccgacctgcttccat<agc>attgaaatgtccttgattggagattttacgcaggaggactgataagttcgggtctgaattgatgc<agc>gaacgttcatccaatactcagacttgcactcagtcg

O que se pretende é calcular a média das distâncias (nº de caracteres) entre os motivos. A minha dúvida é exactamente esta: como consigo extrair os caracteres entre os motivos?

Há por aí um tópico sobre o R que eu abri, não foi foi muito participado.

O R é um software estatístico gratuito, não muito “user friendly”, mas que tem muitos “packages” escritos para Bioestatística (não sei muito bem o que é Bioinformática).